e-escola

Identificação do agrupamento de genes bce, envolvidos na síntese do exopolissacárido Avançado

Publicado em 18/11/2005 

Identificação das zonas flanqueantes do local onde se inseriu o plasposão

A obtenção dos vários mutantes da estirpe B. cepacia IST408 não produtores de cepaciano foi conseguida por inserção aleatória de um plasposãoGlossário. Deste modo torna-se possível e essencial determinar o local exacto onde se inseriu o plasposão. Uma vez que a região do plasposão que é efectivamente inserida no genoma é constituida pelo gene que confere resistência à canamicina e por uma origem de replicação oriR em E. coli, é possível (após utilização de uma enzima de restrição para a qual não existem locais de reconhecimento dentro da sequência do plasposão) recuperar as regiões adjacentes de B. cepacia onde se inseriu através da recuperação do replicão (obtido após ligação com DNA ligase) após introdução por transformação em E. coli (saber mais).

Encontra-se esquematizado na Figura a estratégia seguida para cada um dos mutantes não produtores de exopolissacárido de B. cepacia obtidos por mutagénse aleatória. Assim, procedeu-se à extracção de DNA total de cada mutante, aplicou-se a enzima de restrição EcoRI e as extremidades dos vários fragmentos foram ligadas, formando moléculas circulares. Esta mistura de ligação foi introduzida em E. coli e só aquelas moléculas que continham a origem de replicação oriR e o gene de resistência à canamicina, foram capazes de replicar nesta estirpe na presença do dito antibiótico. As colónias obtidas albergam então um plasmídeo que contém a região do plasposão, flanqueada pela região do genoma de B. cepacia IST408 compreendida entre os dois locais EcoRI. Após extracção deste plasmídeo, determina-se a sequência das regiões que flanqueiam o plasposão, recorrendo para tal aos iniciadores 5'KMR (TTCCCGTTGAATATGGC) e ORIR-1 (CCTTTTTACGGTTCCTGGCCT).

IAB 1

Autor e Créditos

Autor:

 

Para comentar tem de estar registado no portal.

Esqueceu-se da password?

© 2008-2009, Instituto Superior Técnico. Todos os direitos reservados.
  • Feder
  • POS_conhecimento